Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM130
Clone ID RRM130
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM130
Sequence
CAGATACTTCTGCAGCTTGTTTGCGCCCCGGAAGCTGCCCCTGCTCGGGGGTCACGATGGGCAGCAAGATGGCTTCCGCC
ACCAGGGTCGTG
Sequence Type mRNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101514488..101514579 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es