Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM132
Clone ID RRM132
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM132
Sequence
ACCAGGTCCAGCGGAGACGGGAACAAGATGGCGATCCCGGGCAGGCAGTATGGGCTTATTTTGCCAAAGAAAACACAGCC
GTTGCACCGAGTTTTACAGAAACCGTCAGTGTTTGGGAGTGATTCTGATGACGATG
Sequence Type mRNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76890158..76891927 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es