Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM146
Clone ID RRM146
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM146
Sequence
TCTCGGCTCTAGACCCTAGGTCTAGGGCGGGGTACATTCTGCCGGGTTACCTCTCCTGGCTGAGGGGCAACGGCACACCT
CGGGCTTTACCATGGAGGACTACCTGCAGGACTGTCGAGCCGCTTTG
Sequence Type mRNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95085510..95085636 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es