Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM165
Clone ID RRM165
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM165
Sequence
GACACAGTCCGAGCCGGGGGCACCGCCCCCTCGTCTGCCCAGCAGCAGCCCGAGAGCGGCGACGCGGACTGTCAGGAGCC
CCCCGAAAACCCCTGCGACTGTCACAGGGAGCCGCCCCCCGAGATCCCAGACATCAACCAACTGCCGCCGTCCATCCTGC
TTA
Sequence Type mRNA
Unitrap ID UNI7930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 63848376..63848538 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023965 (Fbxl17) F-box and leucine-rich repeat protein 17 Gene [Source:MGI Symbol;Acc:MGI:1354704]

 
Come back to gene ENSMUSG00000023965


For any suggestions or comments, please send an email to unitrap@crg.es