Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST112403
Clone ID OST112403
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST112403
Sequence
TTCTAATTTTGAAACCCCCAAGGAGTCCTCTTCAGGACCTCAAATGTGGAAATCAAACAAACCAGGAACCTAATCCTCCA
AGAAAAAGGAAAAGCTCTCGTCGAGTCAGCTTTGCAGATACTATAAAAGTATTCCAGACAGAGTCTCACATGAAAACAGA
GAGAAATTCAGAAATTTCAGGTATGAACACTTTGCTTTGTGCTCCAATTCAGACTCAGATGCAACAAAAGGAGTTCTCAA
TTACAGACTGCAACCATGAAAGGAAACATGCAAATGATCAGACAGTCATCTTTTCAGATGAAAACCAGATGGATCTGACA
GCAAAGTCACACTGTAATGATTACCAAAGGTCTTTCAGACTGTACCAAAAATGAAAATTCTACAAAAATAGATACCACGT
CCTTTC
Sequence Type mRNA
Unitrap ID UNI26532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118885280..118894030 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]

 
Come back to gene ENSMUSG00000027326


For any suggestions or comments, please send an email to unitrap@crg.es