Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST112296
Clone ID OST112296
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST112296
Sequence
ACTGAGGTGGGGTCTTTCAAAGCTTCNTCGAACCATTANCAGAAACTATCACAGATGTTCTTGTAAGGACGAANCGGGAC
TGGCTTGTCAAACAAAGAGGCTGGGATGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGNGGCATCNCGAAATG
TCGCTGCTGGCTTTTGCTGGGTGTNGCTGGAGTAGGGGCCTGGTCTGGCATATCTAATAAGATAGCCTTGCGAGTGCAAT
AGGGGACTCTTAAAGCTNCAGCCACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTG
CCCAGGATTTTAACAGTCCAGTTCTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATA
AATACATGGGAAAAGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95463846..95464938 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es