Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST112134
Clone ID OST112134
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST112134
Sequence
CATTCCTTGCGGTATTTGGTAACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGCTACAT
GAACTACATGCAGTTTATGCTGCTTTGACAGTGATGGAACTACTCAGAGGATCCAGGCGCAGAGGGCCCTGGGTGAAGCA
GATGGGGCCTGTGTATTTGGAGATGGAAAGAAGGAAAATGGAGAGCTATTCACACAGGGCCCGAGAAAACCTGCGATTCN
CAATCCAGGTCTACAACCAGAGCGACAAGGTTGCAACATGGGGCCAGACCGACGCCTCCTCCGTGGGCACCATAGACATG
CTTTTGATGGCAGCTATTACATCATTCTGAACTTGGACCGGAAAACATGGACTGAGGCAGACAGTACGGCTCAGATCACC
CAGCGACAGTGGAAGGCAGAAGGTGTAGCAGAGGCCTTCAGCCACTTCTTGAAAGNCTTCTTGTGTTCAGTGGCTACTGA
GGCACTTGGAGATAGGGAAGGAGACTCTACAGCGCTCAGACCCCCCCCCCCAAAAAAG
Sequence Type mRNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107266..37108053 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es