Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ388
Clone ID RRJ388
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ388
Sequence
CAGTGATTATTTCTGTGCCATGTTCACTAGTGAGCTTTCAGAGAAGGGGAAGCCGTATGTTGACATTCAAGGTTTAACTG
CTGCTACCATGGAGATCCTGCTGGACTTCGTGTACACAGAAACAGTACATGTGACAGTGGAGAATGTTCAAGAACTGCTC
CCTGCAGCCTGTCTTCTTCAGCTGAAAGGTGTGAAACAAGCCTGCTGTGAGTTCTTAGAAAGTCAGCTGGATCCATCTAA
TTGCCTGGGTATCAGGGATTTTGCTGAAACTCACAATTGCGTTGACCTGATGCAAGCAGCTGAGGTGTTTAGCCAGAAGC
ATTTTCCTGAAGTGGTGCAGCACGAGGAGTTCATTCTTCTGAGTCAAGGGGAGGTGGAGAATGCTAATCAATGTGCGACG
AGATTCAGGTGGATTCTGAAGAGCCA
Sequence Type mRNA
Unitrap ID UNI7942

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136355210..136368988 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026455 (Klhl12) NM_153128 kelch-like 12 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl12-002]

 
Come back to gene ENSMUSG00000026455


For any suggestions or comments, please send an email to unitrap@crg.es