Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST112042
Clone ID OST112042
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST112042
Sequence
GGAACCACGAGCGCANGCGCCTGCTGATNGAGGACTTGGAGGCCAGGATCGCCCTCATGCCGCTCTTCCAGGCAGAGAAG
GACCGGAGGACCCTGCAGATTCTCCGGGAAAACCTGGAGGAGGAAGCCATCATCATGAAGGATGTGCCCAACTGGAAGGN
GGGCGAGTCTGTGTTCCACACCACACNATGGGTGCCACCCCTCATTGGCGAGATGTATGGGTTGCGCACCAAGGAGGAGA
TGAGCAATGCCAACTTCGGCTTCACCTGGTACACTTAGGGCCTGAGCCAACGCACATAATAAAGAGTGGTCAAATAAAAA
AAA
Sequence Type mRNA
Unitrap ID UNI26538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72418079..72418477 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036199 (Ndufa13) NM_023312 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 Gene [Source:MGI Symbol;Acc:MGI:1914434]

 
Come back to gene ENSMUSG00000036199


For any suggestions or comments, please send an email to unitrap@crg.es