Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ458
Clone ID RRJ458
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ458
Sequence
GATTTACTGGTGTACAACTTGGACCTTGGTGGGCATCTCCGAATGGTGAAGAGAGTCCAGAACCTGCTTGGTCACTTTCT
CATCCATGGGTTCCGAGTGCGACCAGAGCCTAAAGGAGACCTGGACTCTGAGGCCATGATAGCTGTGTTTGGGAGCAAGG
GCCTCAAAGTTGTGAAAGTCAGCTGGGGTTAA
Sequence Type mRNA
Unitrap ID UNI7945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108478711..108478902 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066357 (Wdr6) NM_031392 WD repeat domain 6 Gene [Source:MGI Symbol;Acc:MGI:1930140]

 
Come back to gene ENSMUSG00000066357


For any suggestions or comments, please send an email to unitrap@crg.es