Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST111804
Clone ID OST111804
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST111804
Sequence
CGACTCCTGTCCTGATTGGGATAGTAGAGAAAGCTGGGGCCATGAAAGCTACAGTGGAAGTCACAAACGCAAGAGAAGGT
CTCACAGCAGTACTCAGGAGAACAGGCACTGTAAACCACATCATCAGTTTAAAGACTCGGATTGTGCTTC
Sequence Type mRNA
Unitrap ID UNI23310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51080691..51080833 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020385 (Clk4) NM_007714 CDC like kinase 4 Gene [Source:MGI (curated);Acc:Clk4-001]

 
Come back to gene ENSMUSG00000020385


For any suggestions or comments, please send an email to unitrap@crg.es