Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ583
Clone ID RRJ583
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ583
Sequence
GTATGCAGAACAACATTTTGCAGATGTCGTACTTAGTGAAGAGTTTTTTAACTTGGGCATCGAGCAGGTGTGCAGCTTAA
TCTCCAGTGATAAACTCACCATTTCCTCCGAGGAGAAGGTATTTGAAGCAGTCATCGCCTGGGTAAACCACGATAAGGAC
GTAAGACAGGAGTTCATGGCTCGGCTCATGGAGCATGTCCGATTACCTCTGCTTCCTCGGGAGTACTTGGTGCAGCGGGT
TGAAGAGGAAGCATTGGTGAAGAACAGCAGTGCGTGCAAAGATTACCTCATTGAAGCCATGAAGTACCACCTGCTGCCGA
CAGAG
Sequence Type mRNA
Unitrap ID UNI7950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67236949..67243032 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031605 (Klhl2) NP_848748 kelch-like 2, Mayven (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924363]

 
Come back to gene ENSMUSG00000031605


For any suggestions or comments, please send an email to unitrap@crg.es