Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST111189
Clone ID OST111189
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST111189
Sequence
GGCCCAACAAACGCGGGATTNCCGGACGAGCCCATGCTGGGAGTATATGCATCATCTCCTGGCCCTGGAGCACCGTGCTG
AGGAGCATGTTTCTGGAGCACTGGCTGAATCCTCACTGCAAGCCGCACTGTGACAGGAACATTGTCCATCCTGTGTGAAG
GACCTGGGGCCAGGNNGGTGTGTCCTAGGCCTTCTGTTGGAGAGGGTGACTATTGGAACAAGCACGCTGACAGGCAGTGA
TCCAGAGACTGCTGGGGCAGAGAGAAGCTTACCTTCTATTTAATCTGAAGCCTTANAAACAATGCCTTCTGACCTCAAGA
ACACGTGGCTCTTAGNGAGCAGGCCGGAAGTTGCCTTGGGGGNAAATGATGAACATTGTATTCTGCTCCATTTTACTAAC
CCCGNCTACATTGTGAAAACTAACAGCTTTGAAGCTCCTGACGGCCTTCCTGCCAGTTC
Sequence Type mRNA
Unitrap ID UNI25299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88936366..88954231 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]

 
Come back to gene ENSMUSG00000072553


For any suggestions or comments, please send an email to unitrap@crg.es