Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST111105
Clone ID OST111105
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST111105
Sequence
GGTCGCCCCTGGAGATGCGGGGATGTCCATCGTCGGGCCTCGAGGCCCCCCTGGCCAGCCTGGTACCCGAGGTTTNNCTG
GATTCCCGGGTCCCATTGGTCTTGACGGCAGGCCGGGCCACCCCGGACCTAAAGGGGAGATGGGCCTGGTGGGTCCTCGA
GGACAACCGGGACCTCAGGGACAAAAGGGAGAAAAGGGTCAGTGTGGAGAGTACCCACACAGGGTAAGTGATACTTCAAG
CCAAGGGTGTTCTATGGGCTATCCTGAAGCCCAGCCACTACCAGGGTTGGAGGATAGGAGAGTTGAGGGTCAGGGAGTTG
GGGGAGGAACCCTGCTACACTG
Sequence Type mRNA
Unitrap ID UNI20163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61355586..61365885 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]

 
Come back to gene ENSMUSG00000058806


For any suggestions or comments, please send an email to unitrap@crg.es