Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST111032
Clone ID OST111032
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST111032
Sequence
GGGCCCTGCTGTGTGGGGACTGATAGCACANATTGACCGGAAACTTTATAAACAGAACATGCAGAAAGAAATCCTGAGCA
CGCCCCTACTCACTGTTCAGGAGGGAGCTGTAGAAGATCTAGTTCTTGCAGAACCAGAGCCTGGGTACCCTGGGAAGTCC
AGGGTCAGAGGTGTTGTCCTGGGTATGTACTGGCTAATAATGCTAATACCAGCCTAGCAAACTCTGTGAGAAACTTGCTT
TAGAGAAGAGCATGCAGACATTTTTGCTGTTCCAGGAAATTCTGGTTTTCAATGCCTGGGG
Sequence Type mRNA
Unitrap ID UNI26556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78297362..78297759 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032342 (Mto1) NM_026658 mitochondrial translation optimization 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Mto1-001]

 
Come back to gene ENSMUSG00000032342


For any suggestions or comments, please send an email to unitrap@crg.es