Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110851
Clone ID OST110851
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110851
Sequence
CATGTGGGCCCCTGTTCTGGCAGATGGAAATCANCCTCACCTNCTGGGGGACAGGCTGCCCATCTCGTTGATAAATTGAC
TATGCCAATAAATTAACATGG
Sequence Type mRNA
Unitrap ID UNI18686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174286585..174286685 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016252 (Atp5e) NM_025983 ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit Gene [Source:MGI (curated);Acc:Atp5e-001]

 
Come back to gene ENSMUSG00000016252


For any suggestions or comments, please send an email to unitrap@crg.es