Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110819
Clone ID OST110819
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110819
Sequence
GGCTCCACAGGAGGCNTGGCANCNGTCCTTACTATCGACTGNCTCCTGCTNGACNANTGGNAACTAAGGNACCTNGNGGA
TNGACCNTATGANATANNGCTTCANCCANGACTGNTNNNTCTATNTCCTTGGCTCACACTGNATTNACCCCNACTGGAGA
CTGNTACATACGCTCNGGAGANTGAAGCATAGACAGTATGNGCCNAGCCCATNACCGTCTACTGGGATCGNGACATGTGA
TCAAGCATCATGATGCTCTGAAGATTCATTTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATG
CACGCAGAAAGAAATAGCAATGTACACATCACCTTCTTTATATCTTACTTTAAATGTTTTATGCATGTTTTCAAAAATTG
GAAATATCCTAGATAGCTGAGCAATAAATCTTCAATAAGTATTTTG
Sequence Type mRNA
Unitrap ID UNI13977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121976766..121978578 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060802 (B2m) NM_009735 beta-2 microglobulin Gene [Source:MGI (curated);Acc:B2m-001]

 
Come back to gene ENSMUSG00000060802


For any suggestions or comments, please send an email to unitrap@crg.es