Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110549
Clone ID OST110549
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110549
Sequence
GACAAGCGAACCATCGAAAAGTTTGAGAAGGAGGCTGCTGAGATGGGAAAGGGCTCCTTCAAGTACCGCCTGGGTCTTAG
ACAAACTGAAAGCTGAGCGTGAGCGTGGTATCACTATTGACATCTCCCTGTGGAAATTCGAGACCAGCAAATACTATGTG
ACCATCATTGATGCCCCAGGACACAGAGACTTCATCAAAAACATGATTACAGGCACATCCCAGGCTGACTGTGCTGTCCT
GATTGTTGCTGCTGGTGTTGGTGAATNTTGAAGCTGGTATCTNCAAGAACGGGCAGACCCGNGAGCATGCTNTTNTGGCT
TACACCCTGGGTGG
Sequence Type mRNA
Unitrap ID UNI22301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78327847..78328359 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]

 
Come back to gene ENSMUSG00000037742


For any suggestions or comments, please send an email to unitrap@crg.es