Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110429
Clone ID OST110429
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110429
Sequence
CTTCCTGCCGTGGACACAGCAGAACAAGTTTATATCTCTTCCTTGGCCTTGCTAAAGATGNTAAAACATGGTCGTGCTGG
AGTGCCTATGGAAGTTATGGGTCTAATGCTTGGTGAATTTGTTGATGATTACACCGTCAGAGTGATTGATGTGTTTGCTA
TGCCACAGTCAGGAACTGGTGTCAGTGTTGAAGCAGTTGATCCAGTGTTCCAAGCCAAAATGTTGGATATGCTGAAACAA
ACAGGAAGGCCCGAGATGGTTGTTGGTTGGTATCACAGTCACCCTGGCTTTGGCTGTTGGCTTTCTGGTGTGGATATCAA
CACTCAGCAGAGCTTTGAAGCCTTGTCGGAGAGAGCTGTGGCAGTGGTTGTGGATCCCATTCAGAGTGTAAAAGGAAAGG
TTGTTATTGATGCCTTCAGACTGATCAATGCTAATATGATGGTCTTAGGACATGAACCAAGACAAACGACTTCAAATCTG
GGCCAC
Sequence Type mRNA
Unitrap ID UNI1569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61598710..61614816 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es