Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110162
Clone ID OST110162
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110162
Sequence
CCCGTCACACACCCCGATTTCGAACCAAGCACTGAAGTGAGAAACATTTGTTTTTAAACAACNTGCTCTAATAGTCTTAC
ATTTAAAAAATAAGACGATGCTTCCTATTAAACTTGCTATTATAATATAGATAATTAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13365

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 97153367..97153503 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030061 (Uba3) NP_001104576 ubiquitin-like modifier activating enzyme 3 Gene [Source:MGI Symbol;Acc:MGI:1341217]

 
Come back to gene ENSMUSG00000030061


For any suggestions or comments, please send an email to unitrap@crg.es