Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST110102
Clone ID OST110102
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST110102
Sequence
ATCACCCTCAACTATCAGGNTCGGGGTGCTAGGTTTCCTGANCACTGNAGATNANGCTGNCAAGGGCAACTATGGGCTCC
TTGATCAAATCCAGGCCCTTCGCTGGGTGAGTGAGAATATTGCCTTCTTTGGAGGAGATCCCCGTAGAATTACTGTCTTT
GGCTCTGGCATCGGTGCATCCTGTGTCAGTCTCCTTACACTGTCTCATCATTCTGAGGGGACTCATGGAGCCTGG
Sequence Type mRNA
Unitrap ID UNI26570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98504215..98521057 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031302 (Nlgn3) NM_172932 neuroligin 3 Gene [Source:MGI (curated);Acc:Nlgn3-002]

 
Come back to gene ENSMUSG00000031302


For any suggestions or comments, please send an email to unitrap@crg.es