Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST109867
Clone ID OST109867
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST109867
Sequence
CGTCCGTGTATTTCGAACTAACTTCTTCATTCAGCTGGTGCGGCCTGGTACTGCACAGCCTGAAGATACCGTGCAGTTCC
GGATCCCCATGGAGATGACCAGGGTGGACCTTCGGAATTACCTTGAGCAGATTTACAATGTTCCCGTGGCTGCCGTGCGC
ACACGGGTGCAGCATGGCTCCAACAGGAGGAGGGATCACAAGAATGTGAGGATCAAGAAACCAGACTACAAAGTGGCCTA
CGTGCAGCTGGCCCATGGGCAGACCTTCACTTTCCCAGATCTTTTTCCAGAGAAGGACCCCCGTTCTCCAGAACCTCTGG
AAGAGGAGCTACCCCAGCAGAGGCAAAGCAGCGACCTGAGGTGCCCTGGTATCCCTTCCTGGTTTGGCCTATGACCTATG
ACAGCAGGATTTGGACCACAGACCCTAGTGAGCACAGTGGTTCTGACAAGCCCAAATAAAAATTCTTTGTGGA
Sequence Type mRNA
Unitrap ID UNI24210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 149720942..149726646 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037772 (Mrpl23) NM_011288 mitochondrial ribosomal protein L23 Gene [Source:MGI (curated);Acc:Mrpl23-001]

 
Come back to gene ENSMUSG00000037772


For any suggestions or comments, please send an email to unitrap@crg.es