Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST109796
Clone ID OST109796
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST109796
Sequence
TGCTGTTTGCCAGTGGAGGCTTCAAGGTGAAACTCTATGACATTGAGCAACAGCAGATAACAGACGCCCTGGAAAATATC
AGGAAGGAGATGAAATCCCTGGAGCAGTCTGGTTCTCTCAAAGGCTCCTTGAGCGCAGAGCGGCAGCTGTCTCTCATCAG
TGGCTGTGGCAACCTGGCCGAAGCAGTAGAGGGCGCTGTGCACATTCAG
Sequence Type mRNA
Unitrap ID UNI26575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57981759..58001676 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021947 (Cryl1) NM_030004 crystallin, lambda 1 Gene [Source:MGI Symbol;Acc:MGI:1915881]

 
Come back to gene ENSMUSG00000021947


For any suggestions or comments, please send an email to unitrap@crg.es