Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI293
Clone ID RRI293
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI293
Sequence
TTGCACTTCCGGCCTGTTGGTGGCCGCGTTTGCCGAAACCCTGTATCCTGACACCCCGGTGGCGCCTGGTCGTTGCCTTC
TTGGGCCTGGCGGTTGCCGAGGGATTTGAGGGGCGGGAATCGCGGAGACGCGTTTGGATCCGCTAGGTGGGAAGCAGGCT
CTTCCGATCGCGGCCTCAGGGGCGCCGAAGGCTCACACCCCTAGCCATGGACTGCAGTCTGGACAGGATGGCTTCGGTGG
TCCCCGGGCAATTTGACGACGCGGATTCCTCAGACAGTGAAAACAAAGAAGTGCAGCCAATCCATGCAGAAGATGGCGGC
GTTCTACTTAAAAGCCTTCAGAATGCTGCAGCAGAGGTGAAGGGCGACGCTGAGACCGATGAGGAAGACGACTATGATGA
TGATGATGATTGGTACTTGGACGATGCAACTGGAAAACTCACCAAGGGTTGTACCTGGAATGGCGGCAGTAACTAT
Sequence Type mRNA
Unitrap ID UNI7976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 38129124..38132140 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021428 (Riok1) NM_024242 RIO kinase 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918590]

 
Come back to gene ENSMUSG00000021428


For any suggestions or comments, please send an email to unitrap@crg.es