Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST109760
Clone ID OST109760
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST109760
Sequence
TTCTCTGTTGCCCCATGGTCCACATCAACGAGCTGCCAGAGAACATTCTCCTGGAGCTGTTCATCCATATCCCGGCCCCA
CAGCTGCTGCGCAACTGCCGCCTGGTCTGCCGCCTCTGGCGAGACCTCATCGATGTGGTGTCCCTATGGAAGCGCAAGAG
CCTTCGAGAGGGCTTCTTCACCAAAGACCGGTGCGAGCCCGTGGAAGACTGGAAGGTCTTCTATATCCTGTGCAGCCTGC
AGAAGAACCTCCTTAGGAACCCGTGTGCTGAAGAGAACCTGAGCTCATGGCGGATAGACTCTAACGGAGGGGATCGCTGG
AAGGTGGAGACGCTCCCTGGGAGCTGTGGCACAAGCTTTCCTGACAACAAGGTCAAGAAGTATTTTGNCACCTCTTTTGA
GATGNGCCTCAAATCCCAGATGGTGGACCTCAAAGCCGAGGGCTACTGCGAGGAGCTGATGGACACCTTTCGGCCTGAC
Sequence Type mRNA
Unitrap ID UNI15795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147520966..147523761 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055401 (Fbxo6) NM_015797 F-box protein 6 Gene [Source:MGI (curated);Acc:Fbxo6-003]

 
Come back to gene ENSMUSG00000055401


For any suggestions or comments, please send an email to unitrap@crg.es