Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI295
Clone ID RRI295
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI295
Sequence
CGGTGACTCCCAAAGACAAGAAGGTTCTTGCAGCACCACAGGAAGAGTCAAATGCTCAAAAAATTGAGGACGTCTATGGT
CTGAATGGTCAAATAGAGCACAAAATAGCTTTTCTGAGAGCTCACGTGCCAAAGGATGTGAAGCTTATACTCATTGGCCA
TTCCGTAGGCACCTATATGACCCTTCACGTGATGAAGCGAGTCCCCGAGCTGCCTGTCGCCCACGCCTTTCTGCTCTTCC
CAACTATCGAACGAATGTCTGAATCGCCCAACGGCAAGTTTGCCACTCCATTTTTGTGCCAGTTTCGATACCTGCTCTAT
GCTACCAGCTACTTACTTTTTAAGCCGTGTCCTGAAGTCATAAAATCTTTCATAATCCAAAAGCTCATGGGACAAATGAA
CATTAAGCTTGAACTTCCTTTGACGGATATCCTTCAACCATTTTGCCTTGCTAACGCTGCCTACCTCGGGAGCCAAGAAA
TGGTCCAGATAGTGAAGCGAGATGATGACATCATAAAGGAGTTTCTCCCTA
Sequence Type mRNA
Unitrap ID UNI7977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8234128..8282694 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]

 
Come back to gene ENSMUSG00000037669


For any suggestions or comments, please send an email to unitrap@crg.es