Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST109279
Clone ID OST109279
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST109279
Sequence
CAGCCCTGCAGGGGCAGGACGGGGACAGGGAAGGAATGTGGGTAGGAGCTGGGGGAGCCCTAGCCCCCAATACCTCCTCC
CTATTTCCCCCTGAGCCTCCAGGGGCCTCGAGCAACATCATTCCTGTCTACTGTGCTCTCCTAGCTACAGTGATCCTTGG
TCTGCTGGCCTATGTGGCCTTCAAATGCTGGCGCTCACATAAGCAAAGGCAACAGTTGGCTAAAGCTCGGACTGTAGAGC
TAGGGGACCCTGACAGGGACCAGAGGCGTGGTGACAGCAACGTCTTCGTGGACTCTCCTCCTAGTCTGGAGCCCTGTATT
CCCAGCCAGGGACCACACCCGGACCTTGGCTGCCAGCTTTACCTGCATATTCCACAG
Sequence Type mRNA
Unitrap ID UNI23800

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110524195..110524762 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032491 (Nradd) NM_026012 neurotrophin receptor associated death domain Gene [Source:MGI Symbol;Acc:MGI:1914419]

 
Come back to gene ENSMUSG00000032491


For any suggestions or comments, please send an email to unitrap@crg.es