Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST109271
Clone ID OST109271
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST109271
Sequence
GCCCTGGTATGGACATCCGGAACAACCTGACCAGGCTACATGAGCTGGAGAACTGCTCAGTCATTGAGGGCCATCTGCAG
ATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCT
GCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3258710..3258931 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]

 
Come back to gene ENSMUSG00000005534


For any suggestions or comments, please send an email to unitrap@crg.es