Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI400
Clone ID RRI400
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI400
Sequence
TGTCACTTGAGCAGAATTGTACAGGCTACAACATTGCTTACGATGGATAAGTATGTACCTGATGACATTCCAAATATAAA
CAGCACATGCTTTAAGTTAAATTCTCTGCAGCTTCAAGCCTTGTTACAAAATTACCACTGTGCACCCGATGAGCCTTTTA
TTCCTACGGATCTCATAGAAAATGTTGTGGCTGTTGCTGAGAACACAGCTGATGAGCTCGCCCGCAGTGATGGCAGAGAC
GTGCAGCTGGAGGAAGACCCAGACCTACAGCTGCCTTTTCTTCTGCCAGAAGATGGCTATTCCTGTGATGTTGTCAGAAA
CATTCCAAATGGTTTACAAGAATTTTTAGACCCTCTGTGCCAGAGAGGATTTTGTAGATTGGTTCCTCACACACGTTCAC
CAGGTACCTGGACAATATATTTTGAAGGAGCAGATTATGAAAGTCACCTTATGCGTGAGAACGCAGAACTGGCCCAGCCT
CTGAGGAAGGAGCCTGAGATAATCACTGTGACTCTGAAGAAGCAGAATGGAATGGGCCTCAGCATCGTTGCAGCCA
Sequence Type mRNA
Unitrap ID UNI2241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13988029..13998860 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es