Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST108633
Clone ID OST108633
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST108633
Sequence
ATGATGATGTGCATGTGAACTTCCTCGGGAAGAGTGGGCTTTGCTGGATTCTTCTCAGAAGAATCTCTACAAAGAAGTGA
TGCTGGAGACCTACAGGAATCTCGCTGCTATAGGCTATGTTTGGGAAGACCATAATACGGAAGAGCATCTTCATATTTCT
AGAAGATATGGAAGGCATGAAAGAAGTCATACTGAACAGCTGCTCTCTGAGTTTATCCAATGTGATAAAGCCTTTGCATT
TCAGAGTCATAACCAAAGACAAGAAAGAATTCATACTGCAGAGACACCCTATGAATGTAACCAATGTGGTAAATCCTTTG
CAAGAAAGAGTCATCTCCTAAGACATAAAAGAACACATACTGGAGAGAAACCCTTTCAATGTTACCAATGTGGTAAAACT
CTTGCTCGAAATACTCATCTCCTACAACATAAAAAAGTACACACTGGAGAGAAACC
Sequence Type mRNA
Unitrap ID UNI4658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150016142..150017873 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079009 (EG245174) predicted gene, EG245174 Gene [Source:MGI Symbol;Acc:MGI:3644476]

 
Come back to gene ENSMUSG00000079009


For any suggestions or comments, please send an email to unitrap@crg.es