Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST108285
Clone ID OST108285
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST108285
Sequence
CTTATNAANTNAANGANCTGACTCTGTGTGGACGCAAAGGCAATCTGCACTTTATACGCTTTCCCNCCCATGACATGCCT
GCTTTTATTCAGATGGGCAGAGATAAAAACTTCTCAAGTCTCCACACTGTCTTTTGTGCCACTGGAGGTGGATCATACA
Sequence Type mRNA
Unitrap ID UNI26605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131099829..131099976 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037514 (Pank2) NM_153501 pantothenate kinase 2 (Hallervorden-Spatz syndrome) Gene [Source:MGI (curated);Acc:Pank2-001]

 
Come back to gene ENSMUSG00000037514


For any suggestions or comments, please send an email to unitrap@crg.es