Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI486
Clone ID RRI486
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI486
Sequence
GGCAAGCTCCTTTCTGTAACTCAGCAGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAG
AGGAGGTTAGTCAAGCTCAGAACTCCAAACAT
Sequence Type mRNA
Unitrap ID UNI2010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175800092..175800202 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078889 (OTTMUSG00000016618) NP_001028295 predicted gene, OTTMUSG00000016199 Gene [Source:MGI Symbol;Acc:MGI:3706570]

 
Come back to gene ENSMUSG00000078889


For any suggestions or comments, please send an email to unitrap@crg.es