Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI488
Clone ID RRI488
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI488
Sequence
GGCTCTTCCAGGTCAAGCTTGCAAGCTCCTTTCTGTAACTCAGCAGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGA
CTCTACTGGGTGTTGTGAGAGGAGGTTAGTCAAGCTCAGAACTCCAAACAT
Sequence Type mRNA
Unitrap ID UNI3681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175100573..175100703 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078901 (RP23-166A1.1) NP_001028295 ethanol induced 1 [Source:RefSeq peptide;Acc:NP_001028295]

 
Come back to gene ENSMUSG00000078901


For any suggestions or comments, please send an email to unitrap@crg.es