Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI494
Clone ID RRI494
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI494
Sequence
CCTGGGCGTGGCGTCCGTGCCCTCGCAGTGGAGGAGCGTCCAGGGGATCCGCGGGGAGAC
Sequence Type mRNA
Unitrap ID UNI8009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29904205..29904264 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039715 (Wdr34) NP_001008498 WD repeat domain 34 Gene [Source:MGI (curated);Acc:Wdr34-001]

 
Come back to gene ENSMUSG00000039715


For any suggestions or comments, please send an email to unitrap@crg.es