Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST107703
Clone ID OST107703
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST107703
Sequence
CGACGGTCCATCCAGGGTGTCTTACACCTTACAGCGCCAGACTATCTTCAACATTTCCCTTATGAAACTGTATAACCACA
GGCCTCTGACAGAGCCCAGCTTGCAGAAGACTGTCTTAATTAACAACATGTTGAGGCGGATCCAGGAGGAACTCAAGCAG
GAAGGCAGCCTGAGGCCTGCATTCACCCCCTCTTCCCAGCCGAGCAACTCACTGAGCGACAGCTACCAGGAGGCCCCGCC
TCCTGCTCCTCACCCCTGTGACCTCGGAAGCACTACACCCTTGGAGGCCTGCCTCACCCCTGCCTCCCTGCTCGAGGACG
ACAACGATGACACTTTTTGCACTTTGCAGGCTGTGCACCCTGCAGCTCCCACTAGACTCTCTTCTGCAGCCCTCCCAGCA
GAGAAGGACAGCTTCTCCTCCGCCT
Sequence Type mRNA
Unitrap ID UNI17159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20547883..20548307 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es