Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI507
Clone ID RRI507
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI507
Sequence
GGCAAGATGGCGGCTGTGTCGGTGTTTCAGCCACCGGTCGGAGGCTTTTCTTTTGATAATTGTCGCAGGAATGCTGTCTT
GGAAGCGGATTTCGCAAAAAAGGGGTTCAAGCTCCCGAAAGCTCGGAAAACTGGCACTACCATCGCGGGGGTGGTGTATA
AGGATGGCATAGTTCTTGGAGCAGACACGAGAGCAACTGAAGGGATGGTTGTTGCTGACAAAAACTGTTCAAAAATTCAC
TTCATATCTCCTAATATTTATTGCTGTGGTGCTGGGACAGCTGCAGACACAGACATGACAACCCAGCTTATTTCTTCCAA
CTTGGAGCTCCACTCTCTGACCACTGGCCGCCTCCCGAGAGTTGTTACAGCTAATCGGATGCTGAAGCAGATGCTCTTCA
GGTATCAAGGTTACATTGGTGCAGCCCTAGTTTTGGGGGGAGTAGATGTTACTGGACCTCATCTCTACAGCATCTATCCT
CATGGATCAACTGATAAATTGCCTTATGTCACCATGGGTTCTGGCTCCTTGGCAGCAATGGCTGTGTTTGAAGATAAGTT
TAGGCCAGATATG
Sequence Type mRNA
Unitrap ID UNI3326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38468955..38499428 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026750 (Psmb7) NM_011187 proteasome (prosome, macropain) subunit, beta type 7 Gene [Source:MGI (curated);Acc:Psmb7-001]

 
Come back to gene ENSMUSG00000026750


For any suggestions or comments, please send an email to unitrap@crg.es