Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST107471
Clone ID OST107471
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST107471
Sequence
TAGGCCTGACGTTAGAGGCAGTCGGAGATNGTCACCACCTTAANATGAGCATTGCTNGNTGCACTGTCCTCCCACCCNAT
CATCCAGACATNANTCAGNCAGGNCTGNGCTGANCCCTTTGAAGCCTTTGAGAAGTGTCTTCGCTTGAATGAGGCAAGCA
GTGGGCAACTGTGCTGAACACATGCGCCGCTTCCTGCAGTGTGCAGAGCAGGTGCAGCCACCAAGTTCACCCACAACTGG
AGAGGCACAGCCCCTGCCTGCCTCCTGACAACCCCTTGGACTTTGAGAAAACCGACATGATTGACCGTCCCACTTGATGT
CCTCGCCTAGAAAGAGTGACAAAGAGTTTTGGAGTCTTGAGGGCCCTGCTGTGTGTCTGGCGCTCCTGGACATCAGGACA
CTAAATAAATAAAGACTGG
Sequence Type mRNA
Unitrap ID UNI12980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956006..128959182 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]

 
Come back to gene ENSMUSG00000037938


For any suggestions or comments, please send an email to unitrap@crg.es