Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST107088
Clone ID OST107088
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST107088
Sequence
GGAACACACGAGAATGGCTCAGCCCCCTCTCTTCTGCCCCTTTTATTTAATAAAAAAACAA
Sequence Type mRNA
Unitrap ID UNI26621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51805009..51805045 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060601 (Nr1h2) NM_009473 nuclear receptor subfamily 1, group H, member 2 Gene [Source:MGI (curated);Acc:Nr1h2-001]

 
Come back to gene ENSMUSG00000060601


For any suggestions or comments, please send an email to unitrap@crg.es