Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ074
Clone ID RRJ074
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ074
Sequence
GTCCAGTTGAAAGAATTAGAAGAAGAGTGGGTCAAGCTGCCAACAGGTGCTCCTAAGCCCAGTCGGTTTCTGCGTTCCCA
ACAAGAACTAGAAGCTAAACTGGAACAGCAACAGTCTGCTGGTGGAGATGCAGAAGGGGGTGGTGATGATGGTGATGAGG
TACCACAGGTAGATGCTTATGAGCTTCTGGATGCGGTAGAGATCCTTTCCAAACTTCCCAAAGACTTTTATGACAAAATT
GAGGCAAAGAAATGGCAAGAGAGAAAAGAAGCTCTGTAGGCTGTAGAAGTACTAGTGAAAAACCCCAAGCTGGAAGCAGG
CGATTACGCAGATTTAGTGAAAGCATTAAAAAAGGTTGTTGGAAAGGACACCAATGTCATGTTGGTAGCTTTGGCAGCAA
AATGTCTTACTGGCTTAGCTGTTGGGCTCAGAAAGAAATTTGTGACTAATATGCAGGACAT
Sequence Type mRNA
Unitrap ID UNI8026

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91396654..91401068 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es