Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST106858
Clone ID OST106858
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST106858
Sequence
AACTGAGGTCTGAGGTTGCTATGTTAATGCTGCTTGTCTTTGGAGTATTGCTTCATGAAGTCCCACTGAGTGGCCAGGAC
AAGGCTCATTCTGAGGCTGACGATGCGCCTGGCAAGGCCCTGTATGACTACTCCAGCCTCCGCCTCCCTGCGGAGCACAT
TCCCTTCTTCTTGCACAATAACAGGCATGTTGCCTCTGTGTGCAGGGAGGATTCCCACTGTCCATATAAGAAACACTTAG
AAAATCTAAACTACTGCTGGGGTTATGAGAAGTCCTGCGCACCAGAGTTTAGATTCGGTTCCCCCGTTTGCAGCTATGTC
GACTTGGGATGGACCGATACTCTGGAGTCAGCCCAGGACATGTTCTGGAGGCAAGCTGACTTTGGATATGCGCGAGAGCG
ACTGGGAGAGATAAGAACGATCTGCCAGCCAGAGAGAGCAGTGAAAAAAAAAAGGA
Sequence Type mRNA
Unitrap ID UNI26627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 97092816..97095480 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035245 (A130022J15Rik) NM_175313 RIKEN cDNA A130022J15 gene Gene [Source:MGI Symbol;Acc:MGI:2141669]

 
Come back to gene ENSMUSG00000035245


For any suggestions or comments, please send an email to unitrap@crg.es