Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST106785
Clone ID OST106785
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST106785
Sequence
AACATGAGGATCGGAATGCGGGGTCGGGAGCTAATGGGCGGCATTGGGAAAACCATGATGCAGAGTGGCGGCACGTTTGG
CACTTTCATGGCCATTGGAATGGGCATACGATGCTAATTAGGGCTAGGATGCCCTGCAATACCTAAACTTCCCCATCCAT
TTCGACCCTTGTACAATAATAAAGTTGTTTTCTTCTCGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155971336..155971530 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067847 (2010100O12Rik) NM_025946 reactive oxygen species modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914317]

 
Come back to gene ENSMUSG00000067847


For any suggestions or comments, please send an email to unitrap@crg.es