Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ104
Clone ID RRJ104
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ104
Sequence
GGACTGTCCTCTGGCGAGCTGGCTTCAAGGGCAAGTCCAAACCCAATCTTCTCAAACAAGAAACCAGCAGCCTGGCCTGT
TGTCTAAGGATCCTGTTTAGAATGTACGTNTGATGAGAACCGCAGGGATTCCTGGGACGAAATACAGCAGCGACTTCTAA
GAGTGTGCAGTGAAGCACTTGCCTATTTCATTACTGTGAACTCCGAGAGCCATCGGGAAGCATGGACGAGCCTCCTGCTG
CTACTTGTAACCAAAACCCTCAAGATAAGCGATGAAA
Sequence Type mRNA
Unitrap ID UNI8036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166715917..166719116 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es