Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST106055
Clone ID OST106055
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST106055
Sequence
TGTCGAAGAAGTGGTNAATGACAGGAGCTGGAAGGTGTTTAATGAACGCTGNCGAGTTCACTTCAAGCCTCCAAAGAATG
AGTAGAGAGAGAGTTTTTTTAAGACTCGGTCATCTCATCGCCTGGGCATGACAGATGTCAGCAGGGCCAGGGTTCTGAGG
GTGGNCTCTGAGCCAGCAGGCTGAGACCTTTGGTTGGTTCA
Sequence Type mRNA
Unitrap ID UNI10335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36090013..36092085 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es