Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ146
Clone ID RRJ146
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ146
Sequence
AGCGTTTTTTTCTTTTTATCTTTTATTTACTTGGGAATGTAAGATGTTCCATTTTCACACCAGCATGGTAGTATTGAGAT
AGCTATTTGTCTATACACGCTGATGTTGAGGAGTAATCTTCAGATGTGGGATTTTTTTTTTTGTTTCTGCTTTTTGGCAC
ATAAATTGGCTATTTCTTCTGGAGTGGATAAGTACAACAGTGACAAATACATGGAACAGTAAAGAAGACCTTGCTCTTAA
ATCCAAGGAACCTGGCTAACTCTGGATCTGACCATATGAAAACTTCAAAGTAAATATGGGTAGCTGACTTCAAGTAACTC
TATGTCAAATAGTCATAGGTTAAGTATCTTCAAAGAACTTGGATATTTCAGAGGATACAAAATAAAAAAACAAACTGGAA
AACATAAAGCTTATAGAGAAGAAATCAACACCTTCTTGTGCAGTCCTTTTGGAATTTGGACTTGCCATGAGGTGTTGAAG
CCTTGTTTCACTGAGTTGGAGAGACTGGACCTAAATGGCGCAGCATGACTTTGCTCCAGCCTGGCTTAATTTTCCTACTC
CTCCATCATCAACAA
Sequence Type mRNA
Unitrap ID UNI7503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112257061..112278087 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es