Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST105862
Clone ID OST105862
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST105862
Sequence
CACGTGGGAACGGCCACNANNNANTCNTGAGGGGGCAGCTCNNNGNGCTACCTGATAATCTNTAGTCCCNATTCTNTAAA
AGCTGGAGGTGGGCCTCAGGCTGAAGATTTACTTCTAGAAGTGCATCTGCGGGACCCAGTGCTGCAAGTGGAAGTCGGGA
AGTTTGTCTCGGGCACCGAGATGCTTCATCTGGCCGTGCTGCACTCCCGGAAGCTCTGTGTCTACTCCGTCTCAGGGACA
TTGGGAAATGTGGAACATTGGAAACCAATATCAGATAAAACTAATGNATGAGCACCATCTTCANAGGACGGCCTGNAATA
TGACGTATGGACCCCTTTAGGG
Sequence Type mRNA
Unitrap ID UNI26648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22301166..22318524 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]

 
Come back to gene ENSMUSG00000035919


For any suggestions or comments, please send an email to unitrap@crg.es