Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST105611
Clone ID OST105611
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST105611
Sequence
ATTGTTGCGGTTGCTGGTTGCTGTTTACTGTTTGCTGCCGGCTGGAGNGCTGGATTGCTGATTGCCAGTCGGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAATGATTTCAATACGCCCTTTCCCC
CTCTGACCTTTCTCTCTTACCTTATGCTGGGGGATTGGAAGGGTGGCANAAAAAAGAACCCAATAAAGTA
Sequence Type mRNA
Unitrap ID UNI14152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6989241..6989470 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063018 (2010204K13Rik) RIKEN cDNA 2010204K13 gene Gene [Source:MGI Symbol;Acc:MGI:1922859]

 
Come back to gene ENSMUSG00000063018


For any suggestions or comments, please send an email to unitrap@crg.es