Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ189
Clone ID RRJ189
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ189
Sequence
AGTTCTTTTTCTCTCCTAGACTCTTCACCGCCTGAGGACACTCCTGTCGTTGCTGCAGAAGCTGCTGCCCCTGTTCCATC
TGCTGTACT
Sequence Type mRNA
Unitrap ID UNI8056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102351550..102351638 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023051 (Tarbp2) NM_009319 TAR (HIV) RNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:103027]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 47382731..47382819 89
NO GENE  

 
Come back to gene ENSMUSG00000023051


For any suggestions or comments, please send an email to unitrap@crg.es