Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ234
Clone ID RRJ234
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ234
Sequence
CCATCTTTACCCCGGCAGGCCGACATCTATCACCATGAAGGTCGAGCTGTGCAGTTTCAGCGGGTACAAGATCTACCCGG
GACACGGGCGGCGCTACGCCAGGACCGACGGGAAGGTTTTCCAGTTTCTTAATGCAAAATGTGAGTCAGCATTCCTTTCC
AAAAGGAATCCTCGGCAGATAAACTGGACTGTCCTCTACAGAAGGAAACACAAGAAAGGGCAGTCGGAAGAAATTCAAAA
GAAAAGAACCCGCCGTGCAGTCAAATTCCAACGAGCCATCACTGGTGCATCTCTTGCTGATATAATGGCCAAGAGGAATC
AGAAACCAGAGGTTAGGAAAGCCCAGCGAGAGCAGGCTATCAGGGCTGCCAAGGAAGCAAAAAAGGCTAAGCAGGCATCT
AAGACGTCAGCCATGGATGCTGC
Sequence Type mRNA
Unitrap ID UNI8062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55966513..55970284 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es