Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104840
Clone ID OST104840
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104840
Sequence
ATGTGAGAATATGGAAGGCGATGGGAGCAGCTTGTTTAATGGGTNAAGAAGAACCTTACTGTGGGAAACCTTATTAATCC
TGTCAGGGGAGGGAGTAGCCATGACCAGTGTCTCAGTGATGTTCTGAACTTTCGGTAAAGTCTTGGGTAGCTTGAAGTTT
ATTGATGGAGAGACTGTGCTTGCCATCGCCTGTCAAGAATGANNAGCCACCCCCTATTCTCTGAACACTGCCAGCTGCTG
TGATAAAGGCTCACCATGGAGGTCTTGTTCACTTTAGCACTGTGGTATTCAAATAAAATTTCAAAAGTCCATAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI14281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47786931..47787245 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023984 (Usp49) NM_198421 ubiquitin specific peptidase 49 Gene [Source:MGI (curated);Acc:Usp49-001]

 
Come back to gene ENSMUSG00000023984


For any suggestions or comments, please send an email to unitrap@crg.es