Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ259
Clone ID RRJ259
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ259
Sequence
CCGCCAGCAGGTGGAGGAAGTCAAAGCTATTAACTTACAGATGTTTCACAAAGTTCAGAGTGCAGAGAGCAGTTTACAGC
AGAAGAATGAAGCCATCGCATCTTTTGAAGGAAAAACCACTCAGGTGATGTCCAGCATGAAGCAAATGGAGGAAAGGTTA
CAGCAGGCGGAACGGGCCAGGCAGGCGGCAGAAGAGCGAAGCCACAAGTTGCAGCAGGAGCTCAGCGGGAGGGGCAGTGC
CCTGCAGCTCCAGCTGTCCCAGCTGCGGGACCAATGCTCAGGTCTAGAGAAAGAACTGAAGTCAGAAAAAGAACAAAGAC
AAGCTCTCCAGAGAGAACTACAGCGTGAGAAAGACACCTCTTGTCTGCTCCAGACGGAGCTGCAGCAAGTGGAAGGCCTG
AAGA
Sequence Type mRNA
Unitrap ID UNI8067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50211148..50218013 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020375 (Rufy1) NM_172557 RUN and FYVE domain containing 1 Gene [Source:MGI (curated);Acc:Rufy1-001]

 
Come back to gene ENSMUSG00000020375


For any suggestions or comments, please send an email to unitrap@crg.es